Top » Catalog » SNPs » FGC32884

$18.00

FGC32884
[FGC32884]

FGC32884
hg38 Position: ChrY:20394607..20394607
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC32884_F TGACCAGCGAAGACACATTG
Reverse Primer: FGC32884_R TGGAAAGAACCCAGCTTTTC
Reviews

Customers who bought this product also purchased
FGC19446
FGC19446
FGC31787
FGC31787
FGC23332
FGC23332
FGC33213
FGC33213
FGC23337
FGC23337
FGC19440
FGC19440
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies