Top » Catalog » SNPs » FGC32885

$18.00

FGC32885
[FGC32885]

FGC32885
hg38 Position: ChrY:21462422..21462422
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC32885_F CATATGTCTAAATAATAAGTGAATTGCTCG
Reverse Primer: FGC32885_R CTGACTCCTGTAAATTCAAATGTAGC
Reviews

Customers who bought this product also purchased
FGC23335
FGC23335
FGC19429
FGC19429
FGC31784
FGC31784
FGC19451
FGC19451
FGC33210
FGC33210
FGC23334
FGC23334
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies