Top » Catalog » SNPs » FGC1

$18.00

FGC1
[FGC1]

FGC1
HG19 Position: ChrY:13111626..13111626
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: .
Forward Primer: FGC1_F CACTGAGTAACTGTCTTTGTTTCTCG
Reverse Primer: FGC1_R CTCCATCCCTGGTTCCAC
Reviews

Customers who bought this product also purchased
BY145
BY145
FGC5441
FGC5441
FGC4492
FGC4492
FGC5419
FGC5419
Z18219
Z18219
FGC4474
FGC4474
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies