Top » Catalog » SNPs » FGC1

$18.00

FGC1
[FGC1]

FGC1
HG19 Position: ChrY:15223540..15223540
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC1_F CACTGAGTAACTGTCTTTGTTTCTCG
Reverse Primer: FGC1_R CTCCATCCCTGGTTCCAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
ZS10609
ZS10609
L858
L858
ZS5002
ZS5002
ZS5878
ZS5878
ZS7726
ZS7726
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies