Top » Catalog » SNPs » FGC1

$18.00

FGC1
[FGC1]

FGC1
HG19 Position: ChrY:15223540..15223540
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC1_F CACTGAGTAACTGTCTTTGTTTCTCG
Reverse Primer: FGC1_R CTCCATCCCTGGTTCCAC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
YSEQ-Beta
YSEQ-Beta
DNA Sample Kit
DNA Sample Kit
L858
L858
ZS10609
ZS10609
ZS5002
ZS5002
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies