Top » Catalog » SNPs » FGC1

$18.00

FGC1
[FGC1]

FGC1
hg38 Position: ChrY:13111626..13111626
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: .
Forward Primer: FGC1_F CACTGAGTAACTGTCTTTGTTTCTCG
Reverse Primer: FGC1_R CTCCATCCCTGGTTCCAC
Reviews

Customers who bought this product also purchased
M267
M267
P58
P58
FGC43128
FGC43128
ZS10488
ZS10488
FGC54413
FGC54413
ZS10287
ZS10287
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies