Top » Catalog » SNPs » FGC1

$18.00

FGC1
[FGC1]

FGC1
hg38 Position: ChrY:13111626..13111626
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: .
Forward Primer: FGC1_F CACTGAGTAACTGTCTTTGTTTCTCG
Reverse Primer: FGC1_R CTCCATCCCTGGTTCCAC
Reviews

Customers who bought this product also purchased
Y20902
Y20902
ZS10633
ZS10633
FT362659
FT362659
FGC57150
FGC57150
FGC43127
FGC43127
FGC11759
FGC11759
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies