Top » Catalog » SNPs » FGC1

$18.00

FGC1
[FGC1]

FGC1
hg38 Position: ChrY:13111626..13111626
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a2b2a~
Comments: .
Forward Primer: FGC1_F CACTGAGTAACTGTCTTTGTTTCTCG
Reverse Primer: FGC1_R CTCCATCCCTGGTTCCAC
Reviews

Customers who bought this product also purchased
ZS11519
ZS11519
FGC44917
FGC44917
FGC4280
FGC4280
FGC44943
FGC44943
FGC48136
FGC48136
FGC49889
FGC49889
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies