Top » Catalog » SNPs » Z192

$18.00

Z192
[Z192]

Z192
hg38 Position: ChrY:26542613..26542613
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream U152. Above Z194
Forward Primer: Z192_F GTTGCCTCCCTGATGTGCAG
Reverse Primer: Z192_R GTCGATCAAAATGTGTCCATCTAACG
Reviews

Customers who bought this product also purchased
BY3851
BY3851
SK2076
SK2076
PF7563
PF7563
BY177884
BY177884
Y140068
Y140068
Y32760
Y32760
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies