Top » Catalog » SNPs » Z192

$18.00

Z192
[Z192]

Z192
HG19 Position: ChrY:28688760..28688760
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream U152. Above Z194
Forward Primer: Z192_F GTTGCCTCCCTGATGTGCAG
Reverse Primer: Z192_R GTCGATCAAAATGTGTCCATCTAACG
Reviews

Customers who bought this product also purchased
Z39589
Z39589
BY3548
BY3548
DF13
DF13
S1523
S1523
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
CTS4705
CTS4705
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies