Top » Catalog » SNPs » Z192

$18.00

Z192
[Z192]

Z192
hg38 Position: ChrY:26542613..26542613
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream U152. Above Z194
Forward Primer: Z192_F GTTGCCTCCCTGATGTGCAG
Reverse Primer: Z192_R GTCGATCAAAATGTGTCCATCTAACG
Reviews

Customers who bought this product also purchased
FGC36902
FGC36902
PF6582
PF6582
BY38872
BY38872
FGC36897
FGC36897
FGC36895
FGC36895
A7974
A7974
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies