Top » Catalog » SNPs » Z192

$18.00

Z192
[Z192]

Z192
hg38 Position: ChrY:26542613..26542613
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream U152. Above Z194
Forward Primer: Z192_F GTTGCCTCCCTGATGTGCAG
Reverse Primer: Z192_R GTCGATCAAAATGTGTCCATCTAACG
Reviews

Customers who bought this product also purchased
FGC5356
FGC5356
CTS10270
CTS10270
CTS10222
CTS10222
Z67
Z67
Y17172
Y17172
Y19751
Y19751
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies