Top » Catalog » SNPs » Z192

$18.00

Z192
[Z192]

Z192
HG19 Position: ChrY:26542613..26542613
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream U152. Above Z194
Forward Primer: Z192_F GTTGCCTCCCTGATGTGCAG
Reverse Primer: Z192_R GTCGATCAAAATGTGTCCATCTAACG
Reviews

Customers who bought this product also purchased
PH2997
PH2997
Y17163
Y17163
A7969
A7969
S8010
S8010
A7993
A7993
Y17172
Y17172
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies