Top » Catalog » SNPs » Z192

$18.00

Z192
[Z192]

Z192
hg38 Position: ChrY:26542613..26542613
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Downstream U152. Above Z194
Forward Primer: Z192_F GTTGCCTCCCTGATGTGCAG
Reverse Primer: Z192_R GTCGATCAAAATGTGTCCATCTAACG
Reviews

Customers who bought this product also purchased
S8024
S8024
FGC6511
FGC6511
CTS4562
CTS4562
Y17160
Y17160
A274
A274
BY3654
BY3654
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies