Top » Catalog » SNPs » PF6155

$18.00

PF6155
[PF6155]

PF6155
hg38 Position: ChrY:7387314..7387314
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: R1a1a1b1a (not listed)
Comments: Below Z282
Forward Primer: PF6155_F ATATCTGTGATTGGGTAATAACCTTATG
Reverse Primer: PF6155_R AGATGATCCTGATAGGTGCATG
Reviews

Customers who bought this product also purchased
Y72918
Y72918
L145
L145
YP5253
YP5253
YP258
YP258
Y37292
Y37292
BY30698
BY30698
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies