Top » Catalog » SNPs » PF6155

$18.00

PF6155
[PF6155]

PF6155
hg38 Position: ChrY:7387314..7387314
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: R1a1a1b1a (not listed)
Comments: Below Z282
Forward Primer: PF6155_F ATATCTGTGATTGGGTAATAACCTTATG
Reverse Primer: PF6155_R AGATGATCCTGATAGGTGCATG
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Y166625
Y166625
YP1337
YP1337
FT186708
FT186708
Y132956
Y132956
YP6476
YP6476
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies