Top » Catalog » SNPs » PF6155

$18.00

PF6155
[PF6155]

PF6155
hg38 Position: ChrY:7387314..7387314
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: R1a1a1b1a (not listed)
Comments: Below Z282
Forward Primer: PF6155_F ATATCTGTGATTGGGTAATAACCTTATG
Reverse Primer: PF6155_R AGATGATCCTGATAGGTGCATG
Reviews

Customers who bought this product also purchased
Y132956
Y132956
YP6476
YP6476
YP254
YP254
A19325
A19325
BY207879
BY207879
YP5248
YP5248
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies