Top » Catalog » SNPs » FGC31784

$18.00

FGC31784
[FGC31784]

FGC31784
hg38 Position: ChrY:11918712..11918712
Ancestral: C
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC31784_F AGGTGTTCTGAACCTCTCCAAG
Reverse Primer: FGC31784_R AGACCAGGTTGCGAGTCTTC
Reviews

Customers who bought this product also purchased
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
FGC23334
FGC23334
FGC32884
FGC32884
FGC19433
FGC19433
FGC23339
FGC23339
FGC33212
FGC33212
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies