Top » Catalog » SNPs » FGC31784

$18.00

FGC31784
[FGC31784]

FGC31784
hg38 Position: ChrY:11918712..11918712
Ancestral: C
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC31784_F AGGTGTTCTGAACCTCTCCAAG
Reverse Primer: FGC31784_R AGACCAGGTTGCGAGTCTTC
Reviews

Customers who bought this product also purchased
FGC32882
FGC32882
FGC23332
FGC23332
FGC33210
FGC33210
FGC19429
FGC19429
FGC23337
FGC23337
FGC19446
FGC19446
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies