Top » Catalog » SNPs » FGC31784

$18.00

FGC31784
[FGC31784]

FGC31784
hg38 Position: ChrY:11918712..11918712
Ancestral: C
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC31784_F AGGTGTTCTGAACCTCTCCAAG
Reverse Primer: FGC31784_R AGACCAGGTTGCGAGTCTTC
Reviews

Customers who bought this product also purchased
FGC23330
FGC23330
FGC32880
FGC32880
FGC19425
FGC19425
FGC23335
FGC23335
FGC32885
FGC32885
FGC19435
FGC19435
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies