Top » Catalog » SNPs » FGC31785

$18.00

FGC31785
[FGC31785]

FGC31785
hg38 Position: ChrY:12978905..12978905
Ancestral: C
Derived: T
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC31785_F ACAGCAAAGGAAACAACCG
Reverse Primer: FGC31785_R ATATGCCAAGATGGGATTGC
Reviews

Customers who bought this product also purchased
FGC23334
FGC23334
FGC32884
FGC32884
FGC19433
FGC19433
FGC23339
FGC23339
FGC33212
FGC33212
FGC19451
FGC19451
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies