Top » Catalog » SNPs » FGC31786

$18.00

FGC31786
[FGC31786]

FGC31786
hg38 Position: ChrY:7289765..7289765
Ancestral: T
Derived: C
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC31786_F CAAAAGAGCACGATTCTGAAAC
Reverse Primer: FGC31786_R AACCCCTGGTCTCAAGCC
Reviews

Customers who bought this product also purchased
FGC19429
FGC19429
FGC23336
FGC23336
FGC32885
FGC32885
FGC19440
FGC19440
FGC31785
FGC31785
FGC33213
FGC33213
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies