Top » Catalog » SNPs » FGC31787

$18.00

FGC31787
[FGC31787]

FGC31787
hg38 Position: ChrY:19167239..19167239
Ancestral: C
Derived: T
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S1051 > FGC17906 > FGC19454
Forward Primer: FGC31787_F TTCATTTGCTTCTTAAAGAGGTTTC
Reverse Primer: FGC31787_R GTTTCAGGAGGAGCCAAGG
Reviews

Customers who bought this product also purchased
FGC19446
FGC19446
FGC31786
FGC31786
FGC23331
FGC23331
FGC32880
FGC32880
FGC19429
FGC19429
FGC23336
FGC23336
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies