Top » Catalog » SNPs » YP268

$18.00

YP268
[YP268]

YP268
hg38 Position: ChrY:20972023..20972023
Ancestral: A
Derived: G
Reference: R1a community
ISOGG Haplogroup: R1a1a1b2a2b1a
Comments: Aka FGC10645. Below F1345 > CTS6 > Y2619 > Y2630 > YP265
Forward Primer: YP268_F GGCGTTCCTCTCCTTCAATAG
Reverse Primer: YP268_R ACCCATACTCCCCATGTTTG
Reviews

Customers who bought this product also purchased
Y2619
Y2619
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies