Top » Catalog » SNPs » M172

$18.00

M172
[M172]

M172
hg38 Position: ChrY:12857709..12857709
Ancestral: T
Derived: G
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2
Comments: DFFRYEx45
Forward Primer: M172_F GAGCCAGATGACCAGGATG
Reverse Primer: M172_R GCAAATAGCAAAAGGGGGTAG
Reviews

Customers who bought this product also purchased
Z22636
Z22636
Y94997
Y94997
CTS668
CTS668
Z1645
Z1645
M4670
M4670
FGC35964
FGC35964
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies