Top » Catalog » SNPs » M172

$18.00

M172
[M172]

M172
hg38 Position: ChrY:12857709..12857709
Ancestral: T
Derived: G
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2
Comments: DFFRYEx45
Forward Primer: M172_F GAGCCAGATGACCAGGATG
Reverse Primer: M172_R GCAAATAGCAAAAGGGGGTAG
Reviews

Customers who bought this product also purchased
DNA Extraction
DNA Extraction
Z8424
Z8424
Z1043
Z1043
Y26712
Y26712
FGC55778
FGC55778
Y12007
Y12007
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies