Top » Catalog » SNPs » M172

$18.00

M172
[M172]

M172
hg38 Position: ChrY:12857709..12857709
Ancestral: T
Derived: G
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2
Comments: DFFRYEx45
Forward Primer: M172_F GAGCCAGATGACCAGGATG
Reverse Primer: M172_R GCAAATAGCAAAAGGGGGTAG
Reviews

Customers who bought this product also purchased
L23
L23
CTS7518
CTS7518
Z6257
Z6257
SK1344
SK1344
Z6253
Z6253
Y20492
Y20492
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies