Top » Catalog » SNPs » M172

$18.00

M172
[M172]

M172
hg38 Position: ChrY:12857709..12857709
Ancestral: T
Derived: G
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2
Comments: DFFRYEx45
Forward Primer: M172_F GAGCCAGATGACCAGGATG
Reverse Primer: M172_R GCAAATAGCAAAAGGGGGTAG
Reviews

Customers who bought this product also purchased
M168
M168
MZ131
MZ131
M215
M215
Z5011
Z5011
E1b-L19 Panel
E1b-L19 Panel
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies