Top » Catalog » SNPs » M172

$18.00

M172
[M172]

M172
HG19 Position: ChrY:14969634..14969634
Ancestral: T
Derived: G
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2
Comments: DFFRYEx45
Forward Primer: M172_F GAGCCAGATGACCAGGATG
Reverse Primer: M172_R GCAAATAGCAAAAGGGGGTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies