Top » Catalog » SNPs » M410

$18.00

M410
[M410]

M410
hg38 Position: ChrY:2883637..2883637
Ancestral: A
Derived: G
Reference: Sengupta et al. 2006
ISOGG Haplogroup: J2a
Comments: .
Forward Primer: M410_F TCATTGACCTTAAGTCTGAGTCCC
Reverse Primer: M410_R ACTGGATACCTTTCTAGGAAGAATTG
Reviews

Customers who bought this product also purchased
M216
M216
YSEQ-Alpha
YSEQ-Alpha
Z6049
Z6049
MF10470
MF10470
PF7381
PF7381
M201
M201
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies