Top » Catalog » SNPs » M410

$18.00

M410
[M410]

M410
hg38 Position: ChrY:2883637..2883637
Ancestral: A
Derived: G
Reference: Sengupta et al. 2006
ISOGG Haplogroup: J2a
Comments: .
Forward Primer: M410_F TCATTGACCTTAAGTCTGAGTCCC
Reverse Primer: M410_R ACTGGATACCTTTCTAGGAAGAATTG
Reviews

Customers who bought this product also purchased
CTS3617
CTS3617
Y130898
Y130898
M438
M438
S23613
S23613
Y86930
Y86930
P38
P38
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies