Top » Catalog » SNPs » CTS7683

$18.00

CTS7683
[CTS7683]

CTS7683
hg38 Position: ChrY:15502486..15502486
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Syn. with CTS7683; downstream M410 CTS10036
Forward Primer: CTS7683_F AGCTCTGGGAGAAATGGAATG
Reverse Primer: CTS7683_R ATTCTTCTCATGCCCCCA
Reviews

Customers who bought this product also purchased
Y164323
Y164323
FGC25576
FGC25576
Y152335
Y152335
M168
M168
P126
P126
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies