Top » Catalog » SNPs » CTS7683

$18.00

CTS7683
[CTS7683]

CTS7683
hg38 Position: ChrY:15502486..15502486
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Syn. with CTS7683; downstream M410 CTS10036
Forward Primer: CTS7683_F AGCTCTGGGAGAAATGGAATG
Reverse Primer: CTS7683_R ATTCTTCTCATGCCCCCA
Reviews

Customers who bought this product also purchased
PF5125
PF5125
FGC56202
FGC56202
Y176993
Y176993
PF5088
PF5088
Y84796
Y84796
BY32955
BY32955
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies