Top » Catalog » SNPs » M12

$18.00

M12
[M12]

M12
hg38 Position: ChrY:7715439..7715439
Ancestral: G
Derived: T
Reference: Underhill et al. 1997
ISOGG Haplogroup: J2b
Comments: DYS260a
Forward Primer: M12_F GGGATCTCACTCTGTTTCTTAGATTGT
Reverse Primer: M12_R CACTGTAAACTTTCCCATATCACTG
Reviews

Customers who bought this product also purchased
M438
M438
CTS3617
CTS3617
Y130898
Y130898
P38
P38
S23613
S23613
Y86930
Y86930
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies