Top » Catalog » SNPs » PF5056

$18.00

PF5056
[PF5056]

PF5056
hg38 Position: ChrY:20668057..20668057
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: not listed
Comments: Extracted from genome study of Sardinian samples; Also observed in I2
Forward Primer: PF5056_F CCCCTCAATATTCCCTTGTC
Reverse Primer: PF5056_R GGTTAAGGGAGGGGCTACAG
Reviews

Customers who bought this product also purchased
Y164257
Y164257
BY114993
BY114993
Z38506
Z38506
Z37823
Z37823
M168
M168
PF7381
PF7381
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies