Top » Catalog » SNPs » PF5056

$18.00

PF5056
[PF5056]

PF5056
hg38 Position: ChrY:20668057..20668057
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: not listed
Comments: Extracted from genome study of Sardinian samples; Also observed in I2
Forward Primer: PF5056_F CCCCTCAATATTCCCTTGTC
Reverse Primer: PF5056_R GGTTAAGGGAGGGGCTACAG
Reviews

Customers who bought this product also purchased
M145
M145
Y154124
Y154124
P143
P143
Y164323
Y164323
FGC25576
FGC25576
Y152335
Y152335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies