Top » Catalog » SNPs » PF5088

$18.00

PF5088
[PF5088]

PF5088
hg38 Position: ChrY:8239389..8239389
Ancestral: T
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples. Downstream L26
Forward Primer: PF5088_F TATAACTATCTAAAATTACATAGACATACACATACG
Reverse Primer: PF5088_R CAGATAGTTTCACATTTATAATCTATTCCTATAAAG
Reviews

Customers who bought this product also purchased
Y7708
Y7708
Y29011
Y29011
Z6049
Z6049
FGC56202
FGC56202
Y176993
Y176993
CTS7683
CTS7683
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies