Top » Catalog » SNPs » PF5088

$18.00

PF5088
[PF5088]

PF5088
hg38 Position: ChrY:8239389..8239389
Ancestral: T
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples. Downstream L26
Forward Primer: PF5088_F TATAACTATCTAAAATTACATAGACATACACATACG
Reverse Primer: PF5088_R CAGATAGTTTCACATTTATAATCTATTCCTATAAAG
Reviews

Customers who bought this product also purchased
M67
M67
L227
L227
Z6065
Z6065
FGC21373
FGC21373
mtComplete
mtComplete
Z467
Z467
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies