Top » Catalog » SNPs » PF5088

$18.00

PF5088
[PF5088]

PF5088
hg38 Position: ChrY:8239389..8239389
Ancestral: T
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples. Downstream L26
Forward Primer: PF5088_F TATAACTATCTAAAATTACATAGACATACACATACG
Reverse Primer: PF5088_R CAGATAGTTTCACATTTATAATCTATTCCTATAAAG
Reviews

Customers who bought this product also purchased
mtComplete
mtComplete
Y28886
Y28886
Y8531
Y8531
Y14678
Y14678
Y7708
Y7708
Y29011
Y29011
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies