Top » Catalog » SNPs » PF5172

$18.00

PF5172
[PF5172]

PF5172
hg38 Position: ChrY:8014788..8014788
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Extracted from genome study of Sardinian samples Downsream L26 > PF5088 > Z2222 > PF5197
Forward Primer: PF5172_F GCAGAGCTCCTACAGAAGAGTC
Reverse Primer: PF5172_R TGGTCACAGGTGAAATGATG
Reviews

Customers who bought this product also purchased
J2-M172 Superclade Panel
J2-M172 Superclade Panel
J2a-PF5197 Panel
J2a-PF5197 Panel
PF5183
PF5183
PF5197
PF5197
PF5196
PF5196
L24
L24
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies