Top » Catalog » SNPs » PF7381

$18.00

PF7381
[PF7381]

PF7381
hg38 Position: ChrY:15594122..15594122
Ancestral: A
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a (not listed)
Comments: Extracted from genome study of Sardinian samples. Downsream PF5050
Forward Primer: PF7381_F TTAAATGTTTACCTGACTGACTTTCG
Reverse Primer: PF7381_R GGGGTCAGTCCTAGGTTCG
Reviews

Customers who bought this product also purchased
M12
M12
Z37823
Z37823
M304
M304
L26
L26
Y29678
Y29678
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies