Top » Catalog » SNPs » Y7708

$19.00

Y7708
[Y7708]

Y7708
hg38 Position: ChrY:16615949..16615949
Ancestral: C
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: J2a1a (not listed)
Comments: Downstream L26 > PF5088 > PF5125 > Z2227 > Z6065.
Forward Primer: Y7708_F TGGTGAGTGTGGTGTCCAAC
Reverse Primer: Y7708_R GTGGTGATCCAGCATGTGAC
Reviews

Customers who bought this product also purchased
FTB646
FTB646
PF4957
PF4957
M339
M339
FT251095
FT251095
FTB953
FTB953
Y57438
Y57438
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies