Top » Catalog » SNPs » Y7708

$18.00

Y7708
[Y7708]

Y7708
hg38 Position: ChrY:16615949..16615949
Ancestral: C
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: J2a1a (not listed)
Comments: Downstream L26 > PF5088 > PF5125 > Z2227 > Z6065.
Forward Primer: Y7708_F TGGTGAGTGTGGTGTCCAAC
Reverse Primer: Y7708_R GTGGTGATCCAGCATGTGAC
Reviews

Customers who bought this product also purchased
M172
M172
Y8531
Y8531
BY32955
BY32955
M9
M9
PF5125
PF5125
Y28886
Y28886
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies