Top » Catalog » SNPs » Y7708

$18.00

Y7708
[Y7708]

Y7708
hg38 Position: ChrY:16615949..16615949
Ancestral: C
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: J2a1a (not listed)
Comments: Downstream L26 > PF5088 > PF5125 > Z2227 > Z6065.
Forward Primer: Y7708_F TGGTGAGTGTGGTGTCCAAC
Reverse Primer: Y7708_R GTGGTGATCCAGCATGTGAC
Reviews

Customers who bought this product also purchased
Y28886
Y28886
M168
M168
PF5088
PF5088
Y29011
Y29011
M96
M96
Z6049
Z6049
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies