Top » Catalog » SNPs » Z2222

$18.00

Z2222
[Z2222]

Z2222
hg38 Position: ChrY:20979867..20979867
Ancestral: A
Derived: T
Reference: Bonnie Schrack (2012)
ISOGG Haplogroup: J2a1 (not listed)
Comments: downstream of L26; upstream of L24
Forward Primer: Z2222_F AGCCATGTCCTTGAAAGGTG
Reverse Primer: Z2222_R CATGTGGGGCTTAAAACCTG
Reviews

Customers who bought this product also purchased
M67
M67
FGC15914
FGC15914
FGC15895
FGC15895
L558
L558
Z7532
Z7532
PH1038
PH1038
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies