Top » Catalog » SNPs » Z2222

$18.00

Z2222
[Z2222]

Z2222
hg38 Position: ChrY:20979867..20979867
Ancestral: A
Derived: T
Reference: Bonnie Schrack (2012)
ISOGG Haplogroup: J2a1 (not listed)
Comments: downstream of L26; upstream of L24
Forward Primer: Z2222_F AGCCATGTCCTTGAAAGGTG
Reverse Primer: Z2222_R CATGTGGGGCTTAAAACCTG
Reviews

Customers who bought this product also purchased
FT46068
FT46068
PF5401
PF5401
FGC34120
FGC34120
Z6064
Z6064
FGC34117
FGC34117
F3369
F3369
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies