Top » Catalog » SNPs » Z2227

$18.00

Z2227
[Z2227]

Z2227
hg38 Position: ChrY:19295380..19295380
Ancestral: T
Derived: C
Reference: Bonnie Schrack (2012)
ISOGG Haplogroup: J2a1
Comments: derived downstream of L26; in M319 and in M67
Forward Primer: Z2227_F TCCCACAGCTGATAGTGCTG
Reverse Primer: Z2227_R TTGCATAGTCCCAGGGTGTC
Reviews

Customers who bought this product also purchased
ZS7528
ZS7528
M172
M172
M267
M267
M9
M9
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
FGC15914
FGC15914
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies