Top » Catalog » SNPs » Z575

$18.00

Z575
[Z575]

Z575
hg38 Position: ChrY:14216989..14216989
Ancestral: A
Derived: T
Reference: Vincent Tilroe (2011)
ISOGG Haplogroup: J2b (not listed)
Comments: Downstream of M102
Forward Primer: Z575_F AATTGTGACAAGGACGAGAAAG
Reverse Primer: Z575_R TATTGTCCTTACCCCAATGTAAAC
Reviews

Customers who bought this product also purchased
M173
M173
PH1568
PH1568
M172
M172
CTS3617
CTS3617
M9
M9
Y130898
Y130898
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies