Top » Catalog » SNPs » Z575

$18.00

Z575
[Z575]

Z575
hg38 Position: ChrY:14216989..14216989
Ancestral: A
Derived: T
Reference: Vincent Tilroe (2011)
ISOGG Haplogroup: J2b (not listed)
Comments: Downstream of M102
Forward Primer: Z575_F AATTGTGACAAGGACGAGAAAG
Reverse Primer: Z575_R TATTGTCCTTACCCCAATGTAAAC
Reviews

Customers who bought this product also purchased
M9
M9
Y130898
Y130898
M96
M96
S23613
S23613
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Y86930
Y86930
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies