Top » Catalog » SNPs » PF5177

$18.00

PF5177
[PF5177]

PF5177
hg38 Position: ChrY:9977920..9977920
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: not listed
Comments: Extracted from genome study of Sardinian samples; Downstream PF5169
Forward Primer: PF5177_F TGTTATTACCCACATGCGAACT
Reverse Primer: PF5177_R CAAGGGATACATGCCATATCTTAGC
Reviews

Customers who bought this product also purchased
Z34460
Z34460
Z7290
Z7290
Z7366
Z7366
L1064
L1064
PF5183
PF5183
PF5197
PF5197
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies