Top » Catalog » SNPs » PF5177

$18.00

PF5177
[PF5177]

PF5177
hg38 Position: ChrY:9977920..9977920
Ancestral: A
Derived: G
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: not listed
Comments: Extracted from genome study of Sardinian samples; Downstream PF5169
Forward Primer: PF5177_F TGTTATTACCCACATGCGAACT
Reverse Primer: PF5177_R CAAGGGATACATGCCATATCTTAGC
Reviews

Customers who bought this product also purchased
L26
L26
PF5172
PF5172
J2-M172 Superclade Panel
J2-M172 Superclade Panel
J2a-PF5197 Panel
J2a-PF5197 Panel
PF5183
PF5183
PF5197
PF5197
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies