Top » Catalog » SNPs » S19231

$18.00

S19231
[S19231]

S19231
hg38 Position: ChrY:15004402..15004402
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Downstream L26 > PF5088 > Z2222 > PF5197 > PF5172 > PF5169 > PF5174
Forward Primer: S19231_F CAAAGCCTCCCTCATCCAC
Reverse Primer: S19231_R TGGAAGCAAGATTGAAATGATATG
Reviews

Customers who bought this product also purchased
PF7421
PF7421
Z34460
Z34460
Z7290
Z7290
Z7366
Z7366
L1064
L1064
J2a-PF5197 Panel
J2a-PF5197 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies