Top » Catalog » SNPs » FGC9883

$18.00

FGC9883
[FGC9883]

FGC9883
hg38 Position: ChrY:13669847..13669847
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1h2 (not listed)
Comments: Downstream L25 > Z7700 > Z7706
Forward Primer: FGC9883_F CTGTTCCAGAAAACAAGCAAAC
Reverse Primer: FGC9883_R AATTGTGTCCAATTCTAAGGTTATG
Reviews

Customers who bought this product also purchased
J2a-L24 Panel
J2a-L24 Panel
FGC34117
FGC34117
L26
L26
PF5197
PF5197
F3369
F3369
Z2222
Z2222
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies