Top » Catalog » SNPs » SK1382

$18.00

SK1382
[SK1382]

SK1382
hg38 Position: ChrY:14446064..14446064
Ancestral: G
Derived: A
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1a8*
Comments: Equal or downstream PF5314 Z426
Forward Primer: SK1382_F ATGCTACAGTTCCCCTGGAG
Reverse Primer: SK1382_R TTGCATTTCCTTCAGAGACG
Reviews

Customers who bought this product also purchased
FGC9942
FGC9942
FT188977
FT188977
Z7706
Z7706
Z33968
Z33968
FGC9965
FGC9965
FGC30649
FGC30649
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies