Top » Catalog » SNPs » A5383

$18.00

A5383
[A5383]

A5383
hg38 Position: ChrY:12959110..12959110
Ancestral: A
Derived: G
Reference: Colin Ferguson (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream MC14 > BY246
Forward Primer: A5383_F TCCTAAAGTGGCCCAGGAG
Reverse Primer: A5383_R AGAGCCACCAGTGTTCCAAG
Reviews

Customers who bought this product also purchased
BY2723
BY2723
BY248
BY248
BY246
BY246
BY2693
BY2693
R1b-MC14_BY246 Panel
R1b-MC14_BY246 Panel
BY2689
BY2689
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies