Top » Catalog » SNPs » BY2687

$18.00

BY2687
[BY2687]

BY2687
hg38 Position: ChrY:15846904..15846904
Ancestral: T
Derived: C
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2c
Comments: Downstream MC14 > BY246
Forward Primer: BY2687_F CCCTTGGAATGTTTTTGAAGTTG
Reverse Primer: BY2687_R CTTGAGTTCACTATGTAACCACTAAAACTG
Reviews

Customers who bought this product also purchased
A5381
A5381
BY248
BY248
BY246
BY246
R1b-MC14_BY246 Panel
R1b-MC14_BY246 Panel
BY2689
BY2689
A5383
A5383
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies