Top » Catalog » SNPs » BY2689

$18.00

BY2689
[BY2689]

BY2689
hg38 Position: ChrY:16574757..16574757
Ancestral: C
Derived: G
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2c
Comments: Downstream MC14 > BY246
Forward Primer: BY2689_F TTTCCAACATCAAACGCATC
Reverse Primer: BY2689_R TCCAAAGAGCAGTAGAGATCAGC
Reviews

Customers who bought this product also purchased
BY2693
BY2693
BY246
BY246
BY2687
BY2687
R1b-MC14_BY246 Panel
R1b-MC14_BY246 Panel
BY2723
BY2723
A5383
A5383
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies