Top » Catalog » SNPs » BY2723

$18.00

BY2723
[BY2723]

BY2723
hg38 Position: ChrY:8018991..8018991
Ancestral: C
Derived: T
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2c
Comments: Downstream MC14 > BY246
Forward Primer: BY2723_F ATATGCTGCAATGCCTCCTG
Reverse Primer: BY2723_R CTGTTCATTTGGGGGTGTTC
Reviews

Customers who bought this product also purchased
A5383
A5383
A5381
A5381
BY248
BY248
BY246
BY246
R1b-MC14_BY246 Panel
R1b-MC14_BY246 Panel
BY2689
BY2689
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies